Food safety management systems Essay Example

Food safety management systems Essay 1.1 Enterobacteriaceae An increased consciousness and a better apprehension of the nutrient industry and its associated hazards with microbiological taints have been the consequence of the broad usage of nutrient safety direction systems in Ireland. Hazard Analysis Critical Control Point ( HACCP ) is the chief nutrient safety system used throughout nutrient industries. Although this system was introduced in the 1960 s it was merely in 1998 that the EU Hygiene of foodstuffs Regulations implemented this referential in all nutrient concerns in Europe ( Food Market Exchange 2001 ) . Microbiological controls are performed to guarantee the quality and safety of the nutrient merchandises. The patterned advance in scientific discipline and microbic engineering hold given a better apprehension of nutrient production, processing and saving and the nexus between the microscopic and macroscopic universe. This relation enables micro-organisms to be exhaustively examined and evaluated. Food borne unwellnesss are the mos t widespread public wellness jobs, making societal and economic loads along with human enduring. In order to seek cut downing the hazard of such unwellnesss and nutrient poisonings, hygiene steps are required in nutrient processing environments ( Microbiological hazard appraisal 2006 ) . The presence of Enterobacteriaceae in nutrient or food-contact surfaces in such environments serves as hygiene indexs. We will write a custom essay sample on Food safety management systems specifically for you for only $16.38 $13.9/page Order now We will write a custom essay sample on Food safety management systems specifically for you FOR ONLY $16.38 $13.9/page Hire Writer We will write a custom essay sample on Food safety management systems specifically for you FOR ONLY $16.38 $13.9/page Hire Writer Enterobacteriaceae are a big household of bacteriums that comprise of at least 34 genera, 149 species and 21 races. Cells are typically 0.3-1.8AÂ µm in length. ( Blackburn day of the month? ) They are rod shaped, Gram negative facultative anaerobes and are natural dwellers of bowels in both worlds and animate beings. They are found extensively throughout the dirt, H2O, on fruit, veggies and cereals. They play a considerable function in human wellness as many pathogens fall under this household which are known to do many infective diseases. Harmonizing to Kang et Al ( 2007 ) a minute sum of 10 settlement organizing units ( CFU s ) of peculiar micro-organisms can take to life endangering infections particularly in the immune-compromised. Salmonella typhimurium is responsible for typhoid disease while Escherichia coli is a common cause of stomach flu. ( Becker et al 2008 ) . Other Enterobacteriaceae associated diseases include infirmary acquired pneumonia, blood stream infections such as bacteraemia and blood poisoning, urinary piece of land infections and intra abdominal infections ( Denton 2007 ) . Enterobacteriaceae have been preponderantly associated with nutrient pathogen eruption. As discussed by Reilly et Al ( 1988 ) 224 eruptions of salmonellosis associated with domestic fowl meat were reported in Scotland entirely between 1980 and 1985. Among the 2245 people infected 12 died. Salmonella typhimurium and Salmonella enteritis were the chief serotypes associated with the eruption. In recent old ages the serotype Enterobacter sakazakii now known as Cronobacter sakazakii been identified as an emerging pathogen. It has been found in infant milk expression and has been the cause of neonatal meningitis and sepsis. It targets immune-compromised babies and those with a low birth weight. ( Van Acker et al 2000 ) In the 1920 s coli-aerogenes ( coliform ) group was indispensable as an index in the proof of equal processing processs in the dairy industry i.e. Pasteurization of dairy merchandises. It is apparent that since the 1950 s the full Enterobacteriaceae household has been preferred over other taxons as marker beings as they are known to be better defined when it comes to their finding and the household includes more beings of significance than other households. In the 1980 s Escherichia coli was foremost used as a mention being in the monitoring of imbibing H2O supplies. ( Mossel and Stryijk 1995 ) A microbic index harmonizing to Moore and Griffith ( 2000 ) is a microorganism that is an index for the possible presence of pathogens. 1.2 Adherence of Enterobacteriaceae to surfaces. The adhesion of micro-organisms to surfaces in the nutrient industry chiefly on treating equipment is one of the major concerns in the equal control of quality and safety of nutrient merchandises. If cleansing and sanitation are deficient, micro-organisms on the surface can last by the development of a biofilm. ( Ortega et al 2009 ) . A biofilm reduces susceptibleness to disinfectant and increases polysaccharide production. The happening of a biofilm can take to post processing taint taking to a lowered shelf life of a merchandise and the transmittal of diseases. In add-on it has been known to do mechanical obstruction, damage of heat transportation, addition in unstable frictional opposition and the corrosion of metal. ( Fuster-Valls et al 2007 ) To day of the month no ideal method for finding the cleanliness of surfaces has been available. The combination of ocular, non microbial and microbiological methods can take to an integrated cleansing monitoring scheme. ( Griffith et al 1997 ) . The ability to quantify micro-organisms on nutrient contact surfaces provides indispensable information for patterning consumer exposure from cross taint in the nutrient industry through nutrient production, nutrient conveyance and in nutrient service environments. Many infective bacteriums have been known to adhere to surfaces particularly unstained steel, glass and gum elastic. Stainless steel is used extensively throughout the nutrient processing and the nutrient conveyance industry. As described by Ortega et Al ( 2009 ) , unstained steel is most widely employed due to its mechanical strength, corrosion opposition and easiness of fiction . Despite looking smooth to the unaided oculus, when chromium steel steel is viewed under the microsco pe it is shown to be really unsmooth with many distinguishable defects. These defects are thought to harbor bacterial cells which with the add-on of H2O and foods would heighten the micro-organism s endurance ( Moore and Griffith 2002 ) . There have been limited surveies on the adhesion behavior on Escherichia coli on chromium steel steel. Ortega et Al ( 2009 ) stated 108cfu/ml of civilization on chromium steel steel for 2 H at 20Â °C was under the sensing bound. In contrast another survey suggested 105cfu/cm2 were found on chromium steel steel after vouchers were inoculated with 108cfu/ml at 4 Â °C for 24 H. 1.3 Sampling of surfaces with swabs and sponges. Harmonizing to Hall and Hartnett ( 1964 ) , a simple convenient sample process would be utile to trace path of infection , for the identification of human bearers, rating of decontamination processs and bacteriological surveillance of the environment which could hence take to in-service preparation of forces concerned with sanitation . Surface sampling is going progressively of import and legion probes have been afoot to happen a simple, dependable, bacteriological trial to find, quantitatively, the healthful quality of environmental, nutrient and hand-contact surfaces. ( Angelotti et al 1958 ) . Cleaning agendas in the nutrient industry are designed chiefly to cut down both nutrient dust and to decrease microorganisms to degrees that pose small or low hazard to both safety and the quality of the merchandise. ( Moore and Griffith 2002 ) Traditional swabs are made from a wooden or plastic shaft with cotton, rayon, Dacron, or alginate fibers which are spun organizing a bud at one terminal. Moore and Griffith ( 2007 ) discourse how the wetting agents applied to swabs have dramatic effects on the sum of bacteriums recovered from a surface. The chief points to be assessed in finding how effectual peculiar swab types are depend on the remotion of bacterial contaminations from a surface, the release of these bacteriums from the swab bud and the subsequent cultivation . It was found that cotton swabs absorbed more liquid than other swabs evaluated. When bacteriums were recovered from wet surfaces it was apparent that coppice textured, Rayon and Dacron tipped swabs removed a significantly fewer CFU s compared to the cotton swabs. It was shown how cotton swabs performed every bit every bit good when trying a dry surface. Moore and Griffith ( 2007 ) province that cotton swabs consist of a secondary wall that is made up of cellulose. This enables the cotton to swell when positioned in wetness to ensue in an increased soaking up of liquid together with bacteriums entrapped indoors. These positive features that enable cotton swabs to take high degrees of bacteriums from a surface are thought to impede the swabs release of the bacterium. It can be predicted that the usage of a swab with a hapless initial absorbency could later ensue in a higher overall bacterial recovery with the assistance of dilutants to ease bacterial release. Moore and Griffith ( 2007 ) besides discuss how it was apparent upon go forthing the swabs at room temperature for 24 H that the release of bacteriums from the cotton swab was greater than other swabs. It was apparent that the bacterium became entrapped within the cotton fibres hence protecting the bacterium and assisting to make a microenvironment enabling the bacterium to last. In contrast to Moore and Griffith ( 2007 ) statements, Copan Italia ( 2010 ) shows how unfastened cell froth swabs have good release of the bacteriums but demonstrated soaking up of 3-5 times less than in traditional fiber swabs due to their construction ( Figure 1 ) . The development of Flocked swabs which have good releasing belongingss and can absorb five times more than cell froth swabs are widely used in clinical nosologies but have nt been applied yet to the recovery of Enterobacteriaceae throughout the nutrient industry. 1.4 Biochemical trials for the sensing and quantification of Enterobacteriaceae and their restrictions. Current biochemical and civilization based checks tend to be cheap and comparatively simple nevertheless there are restrictions with such trials. One of the chief restrictions includes the length of clip that is needed for the sensing and numbering of bacteriums. False- positive consequences, the loss of viability of bacteriums from aggregation to its numbering and the deficiency of growing of feasible yet non cultural bacteriums have been associated with current biochemical and civilization based checks. ( Rosrak and Colwell 1987 ) Today the Gram discoloration process is of common usage in research labs as the first method of designation for a micro-organism. The method was originally published in 1883 by Hans Christian Gram. This technique nevertheless is nt ever demonstrative of true Gram nature. Some Gram positive bacteriums may stain Gram negative due to cell wall harm in the bacteriums by over exposure to O. ( Bahrani Mougeot et al 2008 ) Blackburn ( day of the month? ) stated that the proving for enteral pathogens such as Salmonella requires specific methods that are labour intensive and can take several yearss to finish. Furthermore, infective bacteriums in nutrient are frequently non homogeneously distributed and are present in low Numberss doing sensing hard. Many nutrient production sites chiefly prefer to prove for enteral pathogens in external research labs while the testing of E.coli and Enterobacteriaceae are routinely tested to supply convenient appraisal of possible fecal taint. Many methods published from International Organisation for Standardisation ( ISO ) methods are available, where many processs of sensing are quantitative. The bulk of nutrient makers impose acceptable bounds for a given micro-organism. The Most Probable Number ( MPN ) technique from ISO 4831:2006 ( ISO 2010 ) and plating utilizing pour or spread technique are chiefly used. Violet Red Bile Glucose Agar ( VRBGA ) and Violet Red Bile Agar ( VRBA ) incorporating lactose have been deemed the most popular media for analyzing nutrients for Enterobacteriaceae. Their sensing and numbering are based chiefly on their ability to bring forth acid and gas from the agitation of glucose and milk sugar which is detected by the pH index impersonal ruddy. An sheathing is recommended to guarantee agitation of the saccharides and to cut down the hazard of oxidization every bit good as bettering the specificity of these media and later cut downing intervention from background vegetations or motile strains ( Blackburn day of the month? ) . There has been grounds that non Enterobacteriaceae bacteriums can turn on VRBA and VRBGA hence proposing that this method can impede specificity. The growing of Aeromonas spp has been detected on VRBGA harmonizing to Petzel and Hartman ( 1985 ) and VRBGA has been seen to be insufficiently selective bespeaking 52.4 % of consequences obtaine d to be false- positive ( Wook Oh and Kang 2004 ) MPN methods can supply greater sensitiveness compared with plating techniques when the taint degrees are low. However if the concentration of taint is high the consequences show greater fluctuation and may take to false positive consequences. MPN technique consists of multiple tubings of different media including Buffer Peptone H2O, Enterobacteriaceae enrichment stock. ( See figure 2 ) Enterobacteriaceae are oxidase negative and this trial is used to prove for the presence of the enzyme cytochrome oxidase to corroborate presumptive settlements in correlativity with glucose agar trial which tests for agitation of glucose. If agitation occurs it consequences in abundant production of acerb terminal merchandises ensuing in a color alteration. This method required by ISO described by Rose et Al ( 1974 ) has low preciseness and inordinate clip is necessary for analysis runing from 5-7 yearss. APIa„? designation systems from Biomerieux are used widely throughout research labs. ID32E, is a standardized system in which the designation of Enterobacteriaceae and other not fastidious Gram negative bacteriums can be quickly identified. Many surveies have been reported utilizing API as method of designation including those of Drudy et Al ( 2006 ) and Galani et Al ( 2007 ) . The API/ID32E sensing kit is the most extended of the scope of API merchandises available. It includes 15 designation systems covering all groups of bacteriums encountered in industrial microbiological research labs ( BioMerieux, 2010 ) . The dependability of APIa„? designation systems it used throughout industries. Janda et Al ( 2001 ) stated nevertheless that the trials included in the API 20E strip in 1975 were still the same in 2001 even if the Numberss of taxons in the Enterobacteriaceae household has increased well between those old ages. The ready to utilize Petrifilm system has been released by 3M health care for the sensing of foodborne pathogens. It s easy to utilize technique comprises a selective media under a transparent movie ( 3M health care ) . The media is hydrated by the add-on of bacterial suspension and after incubation seeable settlements can be counted. ( Blackburn? ? ) Despite this method being speedy and convenient, Petrifilm systems are expensive. Restrictions of this technique discussed by Mueller et Al ( 2009 ) show that some settlements shown on Petrifilm are excessively little to see from bare oculus. Therefore the usage of magnification for accurate visual image is required. It was shown that some beings can liquefy the gel on the movie leting spreading of growing and subsequent harm to other bing settlements supplying a lower count of settlements. Standard methods such as conventional civilization and biochemical based checks used to recite necessitate 18-24 H for consequences to be obtained. Progresss in modern molecular biological science have seen the development of molecular checks such as the polymerase concatenation reaction ( PCR ) that have become highly dependable and important in the sensing of bacterial species ( Khan et al 2007 ) . 1.5 Alternate DNA- based method for the sensing and quantification of Enterobacteriaceae 1.51 DNA extraction The rules of DNA extraction as discussed by Jordan ( 2008 ) include the debasement of microbic cell wall to let go of the Deoxyribonucleic acid and to sufficiently take sample constituents which can cut down assay efficiency and degrade the Deoxyribonucleic acid. Due to the complexness of nutrients matrices there are many inhibitors of DNA extraction including saccharides, fats, proteins, metal ions, phenoplasts and cell dust. 1.52 Polymerase Chain Reaction Polymerase Chain Reaction ( PCR ) is one of the most widely used molecular biological science techniques in the research lab. This is due to its specificity, flexibleness, singular velocity and its resiliency ( Mc Pherson et Al 1995 ) . PCR was developed in the 1980 s and the technique has been continuously improved and modified to spread out its versatility and pertinence . This Deoxyribonucleic acid based method has become an indispensable and day-to-day performed experimental technique in many research Fieldss and clinical research labs to observe infective agents, to magnify familial stuffs from limited volumes of DNA sample ( AÂ µl ) and for cloning for sensing of familial look degrees. ( Yang et al 2005 ) . PCR is utile for both the diagnosing and direction of a assortment of infective diseases. ( Louis et al. , 2000 ) PCR Mix: PCR mix is made up of DNA polymerase, a forward and a contrary primer, bases, a DNA Target and PCR buffer with MgCl2. PCR stairss PCR elaboration can turn a few molecules of a specific mark nucleic acid into a mcg of DNA. Roche PCR Applications Manual ( 2006 ) explained how the procedure of PCR occurs in three chief stairss of 1 ) Denaturation, 2 ) Annealing and 3 ) Extension with the usage of temperature cycling ( figure 3 ) . Denaturation occurs at 90Â °C when heat separates double stranded DNA into two individual strands. Since the H bonds associating the bases to one another are weak they break at such high temperatures, whereas the bonds between the deoxyribose and phosphates which are strong covalent bonds remain integral. The end of PCR procedure is non to retroflex the full strand of Deoxyribonucleic acid but to retroflex a mark sequence of about 100-35,000 base brace that is alone to the being. Primers are used to specify the terminals of that sequence. Primers are short, man-made sequences of single- stranded DNA typically dwelling of 20-30 bases. The annealing measure takes topographic point between 40Â °C to 65Â °C depending on the length on the length and sequence of the primers. This allows the primers to temper specifically to the mark sequence. Once the primers anneal to the complementary DNA sequences, the temperature is raised to about 72Â °C and DNA polymerase begins to synthesise new dual stranded Deoxyribonucleic acid molecules that are indistinguishable to the original mark DNA. It does this by easing the binding and connection of complementary bases that are free in solution ( dNTPs ) . Synthesis ever begins at the 3 terminal of the primer and returns entirely in the 5 to 3 way. The new synthesis efficaciously extends the primers, making a complementary two-base hit stranded molecule from a single-stranded templet. After the PCR procedure is complete, cataphoresis must be completed in order to For the sensing of bacteriums within nutrients the mechanism of PCR has proved to be really effectual. Low degrees of 3cells of Campylobacter were found in meat samples utilizing this technique ( Waage et al 1999 ) . However During PCR elaboration, short Deoxyribonucleic acid sequences are copied at each rhythm. Theoretically the sum of Deoxyribonucleic acid at each rhythm should duplicate at each rhythm, ensuing in an exponential elaboration of the initial mark DNA. Fraga et Al ( 2009 ) demo how this is potentially true during the early phases of the reaction when the constituents present in PCR are in huge extra compared to the mark sequence. As the merchandise accumulates, the substrates become low ensuing in suppression. In order to look at the efficiency of the reaction, PCR can be divided into three distinguishable stages: exponential, additive and tableland. The first stage is exponential stage in which the reaction is 100 % efficient with the doubling of merchandise at each rhythm. As the amplicon exponentially accumulates in measure the PCR constituents are used up and the primers begin to vie with the amplicon and the reaction efficiency later decreases. As the reaction slows down the additive stage begins. The merchandise formed in this stage is extremely variable due to the rate at which peculiar constituents are depleted and the accretion of merchandises. The tableland stage is when the reaction Michigans due to depletion of substrates and the suppression of merchandises. There is an highly big difference between the additive stage and the concluding sum of merchandise produced. In conventional PCR, sensing of PCR merchandise is completed late in the additive stage or at plateau stage. As seen in figure 5 there can be a distinguishable difference in the two stages demoing that conventional PCR is variable when it comes to quantitative consequences. 1.42 Real clip PCR The development of existent clip quantitative PCR ( QPCR ) presents more rapid, specific and quantitative numbering of peculiar mark cistrons as they are amplified in existent clip. In existent clip PCR the sum of merchandise formed is monitored during the class of the reaction by supervising the fluorescence of dyes or investigations introduced into the reaction that is relative to the sum of merchandise formed, and the figure of elaboration rhythms required to obtain a peculiar sum of DNA molecules is registered. ( Kubista et al 2006 ) . Real clip PCR checks are characterized by a broad scope of quantification of 7-8 logarithmic decennaries, high proficient sensitiveness, high preciseness and it does nt necessitate any station PCR steps hence the hazard of taint is reduced. ( Klein D 2002 ) Real clip PCR processs follow the same rules of conventional PCR in the readying of mixes and cycling of temperature. This rapid sensing method uses a sensing format, normally a fluorescent dye that binds to the PCR merchandise. The sum of fluorescence generated is relative to the sum of PCR merchandise formed. Initially the signal is weak and hence indistinguishable from the background but as the PCR merchandise accumulates, the fluorescence can be acquired by the existent clip PCR device. A threshold line is developed by the existent clip device and the CT value is determined. CT value is the figure of rhythms required to make fluorescent threshold. Real clip PCR generates a CT value for each DNA sample which is hence relative to the transcript figure DNA. Normally used fluorescent Reporters SYBR Green 1. Asymmetric cyanine dyes such as SYBR Green 1 have two aromatic systems incorporating N, one that is positively charged connected by a methine span. The dye has virtually no fluorescence when free in solution due to quivers prosecuting both aromatic systems, which convert electronic excitement energy into heat that dissipates to the environing dissolver. When the dyes bind with DNA they emit fluorescence. ( Nygren et al 1998 ) As disussed by LightCycler Rea clip PCR Systems ( 2009 ) , SYBR Green binds to all double stranded Deoxyribonucleic acid molecules irrespective of the sequence. When it comes into contact with dual stranded Deoxyribonucleic acid its fluorescence additions significantly. Harmonizing to Monis et Al ( 2005 ) SBYR Green 1 has a restriction in dye stableness and dye dependent PCR suppression and the selective sensing of amplicons during DNA runing curve analysis. HYBRIDISATION PROBES HYDROLYSIS PROBES TAQMAN PROBES LUX PRIMERS SYBR Green 1 is normally used in existent clip PCR. However, these asymmetric dyes nevertheless are considered sequence non-specific newsmans in real-time PCR. They tend to breathe fluorescence signal to all double stranded DNA even unwanted primer-dimer merchandises. Primer dimer merchandises interfere with the formation of specific merchandises due to competition of the two reagents and may take to wrong readings. Melting curve analysis can easy recognize primer-dimer formation. Temperature is increased and fluorescence is measured as a map of temperature. As temperature additions, fluorescence lessenings due to increased thermic gesture. When dual stranded DNA separates an disconnected bead in the fluorescent signal occurs. Since primer-dimers are shorter and they tend to run at a lower temperature, they are easy recognised in runing curve analysis. Light Upon Extension ( LUX primer ) : based on oligonucleotides labelled with a individual fluorophore. They do non necessitate a quencher mediety includes a single-labeled primer with a FAM fluorophore at the 3 terminal in a hairpin construction and a corresponding unlabelled primer, designed to amply the 5 terminal of the cistron encoding the S protein ofTGEV. The constellation of the labelled primer enables the fluorescence slaking capableness. When the primer is incorporated into double-stranded RT-PCR merchandise, the fluorophore is dequenched, ensuing in a important addition in fluorescent signal Unlike the current good known real-time engineering that relies on a man-made DNA investigation labeled with two different fluorescent dyes, LUX primers engineering does non necessitate an expensive investigation so is more suited for everyday research lab diagnosing. What a LUX check demands is a specific primer set with a individual labeled, self-quenched primer and a corresponding unlabelled one, it is more dependable than the real-time method usingDNA bindingdyes that may bring forth potentially deceptive consequences due to the deficiency of specificity of the dyes. A old survey besides indicates that the LUX primers engineering is dependable for quantitation of cistron look and the consequence is similar to the probe-based quantitative check ( Brian et al. , 2003 ) . LUX fluorogenic primers can be designed and ordered via online package. The LUX check besides has the advantage of addition velocity and is less arduous over the gel-based RT-PCR technique that is presently the everyday cistron analysis tool forTGEV. The LUX assay took less than an hr to finish the elaboration reaction and the procedure was viewed in existent clip, while conventional RT-PCR methods normally take more than 1h for cistron elaboration and half an hr or more to run the gel and analyze the consequence. The advantage of velocity of the LUX check is more evident when compared to other everyday diagnostic methods for TGE Furthermore, the LUX check is closed-tube and one-step technique, which reduces the hazard of taint and reaction variableness. This sensitive and specific trial complements bing cistron methods for the sensing ofTGEV. The method shall turn out to be a valuable tool in the research lab diagnosing ofTGEV, particularly as a agency of corroborating positive consequences from serological trials. LUX primers engineering supports manifold elaboration ( hypertext transfer protocol: //www.invitrogen.com/lux ) that makes observing different pathogens in a individual check possible. By utilizing two sets of primers, each labeled with a different dye, a individual LUX check can observe two different viruses. LUX primers are compatible with a broad assortment of real-time PCR instruments ( hypertext transfer protocol: //www.invitrogen.com/lux ) . More checks can be developed for the sensing of other pathogens. By cut downing the cost of real-time cistron sensing and with high public presentation, LUX fluorogenic primers engineering may has the possible to be used widely in the field ofanimal diseasesurveillance and control every bit good as import and export carnal quarantine direction. Advantages of utilizing DNA for microbic Testing Deoxyribonucleic acid is stable and unswayed by environmental factors while being independent from bacterial fundamental law doing consequences conclusive non subjective. It is accurate due to species specific mark sequence which is unattainable with cultural methods and public presentation controls can be added. There are good established DNA sensing methods available which enable fast sensing. Reliable industry of primers and investigations. 2.1 Preparation of Deoxyribonucleic acid from bacterial strains The undermentioned Enterobacteriaceae strains were obtained ( MicroBioLogics Inc, Minnesota, USA ) Escherichiacoli ( ATCC 11775 ) , Serratiamarcescens ( ATCC 13880 ) , Enterobacteraerogenes ( ATCC 13048 ) , Salmonella typhimurium ( ATCC 13311 ) Erwinia persicina ( ATCC 1381 ) Shigella flexneri ( ATCC 9199 ) Klebsiella pneumonia ( ATCC 700603 ) , Yersinia enterocolitica ( ATCC 9610 ) Listeria monocytogenes ( ATCC 19115 ) , Vibrio parahaemoliticus ( ATCC 17802 ) , Aeromonas hydrophila ( ATCC 7966 ) and Campylobacter jejuni ( ATCC 29428 ) . The University of Limerick supplied the strains Cronobacter sakazakii, Enterobacter cloacae, Pseudomonas aeruginosa and Proteus Mirabilis. The National Collection of Type Cultures ( Health Protection Agency Culture Collections, Salisbury, UK ) supplied Staphylococcus aureus ( NCTC 8325 ) . All strains of bacteriums were stored on Protect beads 109 ( LangenBach services Ltd, Dublin, Ireland ) at -20Â °C until cultivation. All Enterobacteriaceae strai ns grown on alimentary agar ( NA ) ( Oxoid, Basingstoke, UK ) at 37Â °C for 24hr AÂ ± 2 hour except Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. Vibrio parahaemoliticus grown at 35Â °C on Trypic soybean agar ( TSA ) ( Oxoid ) Confirmation and Identification of the mention micro-organism E coli. The designation of Escherichia coli ( ATCC 11755 ) was verified by the undermentioned biochemical trials. The Gram discoloration process was applied to a settlement from the fresh civilization on NA. Oxidase trial was carried out utilizing oxidase strips ( bioTRADING, Dublin, Ireland ) . A positive control of Pseudomonas aeruginosa and a negative control of Staphylococcus aureus were used to corroborate the dependability of the trial. API designation utilizing ID 32E was carried out harmonizing to maker s instructions ( BioMerieuxAÂ ®S.A, Craponne, France ) and identified utilizing the package Apiweb ( BioMerieux ) 2.2 Preparation of bacterial suspension. Pre-cultures were prepared by infixing a loop full of bacterial settlement into Nutrient Broth ( Oxoid ) with incubation of 37Â °C for all Enterobacteriaceae with the exclusion of Erwinia persicina which was grown at 30Â °C, Listeria monocytogenes and Staphylococcus aureus grown at 37Â °C. A loop full of Vibrio parahaemolyticus was grown at 35Â °C on Tryptic Soya Broth ( TSB ) ( Oxoid ) In peculiar the growing of Escherichia coli in alimentary stock was studied by mensurating the optical denseness and home base numeration. Spectrophotometric measurings were obtained at 600nm utilizing ( insert name here ) .Optical denseness was acquired every 30min from 0min to 4h 30min 2.3 Usual spiking of vouchers and recovery by swobing. Stainless steel vouchers of class 304 were obtained. Regions to be spiked with Escherichia coli were indicated utilizing a templet ( ) ( 10cm x 10cm ) . Each voucher was spiked by pipetting 100AÂ µl of Escherichia coli civilization onto the surface and utilizing a spreader ( ) . After allocated clip ( 0min 30min or 60min ) , vouchers were swabbed utilizing cotton swab. Each voucher was swabbed twice: horizontally and vertically. Each swab was cut and placed into the interior tubing of swab extraction tubing system ( SETS ) ( Roche Diagnostics, Mannheim, Germany ) .Each aggregation tubing was later centrifuged at 10000g for 10min ( Sigma1-15 ) . Then the inner tubings and the supernatants were discarded. Pellets were re-suspended in 250AÂ µl Ringer one-fourth strength solution ( Oxoid ) . Dilution series in one-fourth strength toller solution were prepared, plated out on alimentary agar and incubated 18-24h at 37Â °C. 2.4 Study of the release of Bacteria from different swabs and sponges. Comparative survey of the recovery of Escherichia coli cells was performed utilizing cotton, rayon and alginate swabs. ( Copan Italia S.p.A, Brescia, Italy ) . 100AÂ µl of 18h Escherichia coli civilization were deposited straight onto each swab. Swabs were cut and placed into SETS tubes. Tubes were centrifuged at 10000 g for 10 min. Pellets were re-suspended with 200AÂ µl of quarter-strength Ringer Solution ( Oxoid ) . Dilution series were made and 100 AÂ µl of diluted sample were plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H. Large sponges ( Medical Supply Co Ltd, Dublin, Ireland ) were tested to retrieve bacteriums from surfaces by swobing after allocated clip ( 0 min, 30 min, 60 min ) . Each sponge impregnated with 10ml Maximal Recovery Diluent ( MRD ) ( Oxoid ) was inserted into a stomacher bag ( ) supplemented with 100ml of MRD and stomached utilizing stomacher ( ) for 120 s at high power. Dilution series were made and 100AÂ µl of diluted sample was plated onto alimentary agar home bases ( Oxoid ) that were incubated at 37Â °C for 24 H 2.5 Detection and Quantification of feasible bacteriums from surfaces. Plate numeration expression was obtained as per ISO 4833:1991 ( Harrigan W.F 1998 ) which has since been renewed to ISO 4833:2003 Microbiology of nutrient and animate being eating materials Horizontal method for the numbering of micro-organisms Colony-count technique . The home base numeration expression was? c/ ( n1 + 0.1 n2 ) vitamin D where? degree Celsius was the amount of all settlements counted on all dishes, n1 was the figure of dishes in 1st dilution, n2 was figure of dishes in 2nd dilution and vitamin D represented the dilution. Miles and Misra method as per Harrigan W.F ( 1998 ) was used in peculiar when proving recovery of Escherichia coli from the big sponges. 2.10 Bacterial designation of bacteriums in the suspension used to make the unreal nutrient environment on surfaces. The suspension was prepared from 34 swabs samples that were collected from nutrient contact surfaces in Dawn Fresh Food Company, Fethard, Co. Tipperary. Each swab was assorted with 0.1 % peptone H2O ( Oxoid ) and the suspension were pooled together to make one chief suspension that was assorted with half volume glycerol 50 % ( Sigma Aldricha„? Inc ) . This suspension was aliquoted into 1ml eppendorf tubings and maintain in at -80Â °C. A entire feasible count was determined by utilizing the Miles and Misra method and later by home base numeration following a dilution series of bacterial suspension. The sensing of Listeria monocytogenes, Staphylococcus aureus and the Enterobacteriaceae were targeted. In the instance of Listeria monocytogenes 1ml of sample was dispensed into 9ml Buffer Peptone H2O ( Oxoid ) . Incubate 37Â °C for 18-24hours. After 24 H transportation 10ml from tubing into 90ml of Listeria Enrichment stock ( Oxoid ) , incubate for 48 H at 30Â °C guaranting agitation. After 48 h a loop full of solution was streaked on a Listeria agar home base ( Oxoid ) and incubated for 48 H at 30Â °C. Listeria Petrifilm ( 3Ma„? , Dublin, Ireland ) was used following maker s instructions. For the designation of Staphylococcus 100AÂ µl of unreal nutrient environment was plated on baird Parker agar ( Oxoid ) administering the organic burden throughout the home base utilizing a spreader and incubated at 37Â °C for 48 h. After 48 h agglomeration was tested utilizing PastorexAÂ ® Staph Plus trial. ( Biorad ) . Catalase activity was tested by the add-on of H2O2 ( ) . Each suspected Staphylococcus aureus settlement was placed in 1ml of toller solution that was later pipetted on to Staph Petri movie ( 3Ma„? ) . Petri movie was placed in brooder for 24 H at 37 Â °C. Enterobacteriaceae was detected utilizing most likely figure ( MPN ) See appendix. 2.6 DNA extraction: For specificity for PCR checks, bacterial pellets were obtained antecedently from civilizations in exponential growing stage were used with the exclusion of Camplyobacter jejuni. One settlement of C.jejuni was resuspended in 0.1 % Peptone H2O ( Oxoid ) and centrifuged at 5000 g for 5 min. For the quantification of bacteriums from surfaces, pellets were recovered from SETS after centrifugation of 1ml of civilization at 5000 g for 5 min. A rapid purification of DNA samples utilizing DNeasy Blood and Tissue Kit ( Qiagen, West Sussex, UK ) was preformed following maker s instructions. Deoxyribonucleic acid was extracted, purified and later quantified utilizing Nanodrop ND 1000 spectrophotometer ( ThermoScentific, Wilmington, USA ) Deoxyribonucleic acid concentrations were adjusted to 1ng per 2AÂ µl 2.7 Choice of Primer sets. 2.7-1 ENT Primers ENT primers developed by Nakano et Al ( 2003 ) and designed to temper to the 16S rRNA cistron of Escherichia coli. The sequence of the forward primer: 5GTTGTAAAGCACTTTCAGTGGTGAGGAAGG 3was 425 through 454 in the E. coli 16S rDNA while the sequence of the contrary primer 5GCCTCAAGGGCACAACCTCCAAG 3 had places 826 through 848 in the E.coli 16S rDNA. ENT primers expected to take to formation of 419-425 bp of PCR merchandise. 2.7-2 IEC primers: IEC primers as described by Khan et Al ( 2007 ) are oligonucleotide primer braces derived from the distal and proximal conserved flanking parts of the16S rRNA cistron, the Internal Transcribed Spacer ( ITS ) part and the 23S rRNA.IEC frontward primer 5CAATTTTCGTGTCCCCTTCG 3 and change by reversal primer 5GTTAATGATAGTGTGTGTCGAAAC 3 had expected PCR merchandise length of 450bp. 2.8 PCR Conditionss For a individual PCR 25 AÂ µl PCR reaction, PCR maestro mixes were prepared with unfertile DNA H2O, PCR buffer 2mM MgCl2, 25mM MgCl2, a dNTP mixture ( dATP, dTTP, dCTP, dGTP ) , frontward primer, change by reversal primer, DNA polymerase and 2AÂ µl of peculiar DNA. PCR was carried out on G-STORM GS2 Thermal Cycler. ( Familial Research Instrumental Ltd, Braintree, UK ) . The elaboration conditions were as follow: stopping point palpebra and heated to 111Â °C, 95Â °C for 6 min, bacterial rhythm start of 28ycles, denaturation measure of 95AÂ °C for 30 s, tempering temp between gradient of 56-62AÂ °C depending on primer type for 15 s, elongation for 30 s at 72Â °C. End rhythm with elongation for farther 7 min at 72Â °C. Cycle was repeated 30 times. 2 % Agarose gel ( Biosciences, Dun Laoghaire, Ireland ) pre-stained with SYBR Safea„? ( Molecular Probes, Eugene, USA ) cataphoresis was run in Tris ethanoate EDTA ( TAE ) . ( Sigma Aldricha„? Inc, Saint Louis, USA ) with Amplisize ( Biorad, Hercules, USA ) as a molecular marker runing from 50 to 2000 bp. The gel was examined in G-BOX ( Syngenes, Cambridge, UK ) under UV visible radiation. Recovery of E coli in the presence of an unreal nutrient environment Innoculum was prepared with pre-culture at the exponential stage when the concentration was 108cfu/ml. 100AÂ µl was pipetted onto chromium steel steel vouchers incorporating different concentrations of unreal nutrient environment ( high, medium or low concentrations ) . After allocated clip ( 0 min, 30 min, 60 min ) vouchers were swabbed at 90Â °angle. Swabs were cut into SETS ( Roche Applied Science ) and centrifuged for 10 min at 6000g. Pellet was re-suspended with 150AÂ µl toller solution leting 50AÂ µl for EMA intervention and 50AÂ µl for home base numeration. Preparation of Propidium monoazide ( PMA ) PMA dissolved in 20 % DMSO to obtain a stock concentration of 20nM and stored at -20Â °C off from the visible radiation. 1.25AÂ µl PMA solution added to 500AÂ µl of civilization aliquots to give a concluding concentration of 50nM following the incubation period of 5minutes in the dark with occasional commixture to let the PMA to perforate the dead cells and to adhere to the DNA. Samples are so put in ice and placed 20cm from 500W halogen visible radiation beginning for 15minutes. Samples centrifuged at 10,000g for 10 proceedingss. Samples washed with NaCl ( ) and MilliQ H2O ( ) in order to take the inactivated PMA. Bibliography. Angelotti R, Foter M.J, Busch K.A, Lewis K.H ( 1958 ) . A comparative rating of methods for finding the bacterial taint on surfaces Public Health Report 79 ( 11 ) pp 1021-1024 available: PubMed database [ accessed 10 March 2010 ] Astrographics ( 2002 ) Escherichia coli bacteria [ image online ] , available: hypertext transfer protocol: //www.astrographics.com/GalleryPrintsIndex/GP2144.html [ assessed 10 March ] Becker, B. , Weiss, C. , Holzapfel, W.H ( 2008 ) An rating of the usage of three phenotypic trial systems for biochemical designation of Enterobacteriacea and Pseudomonadacea Food Control 20 ( 9 ) available: Science Direct [ accessed 13 Feb 2010 ] Bej, A.K. , Steffan, R.J. , DiCesare, J. , Haff, L. , Atlas, R.M. , ( 1990 ) Detection of coliform bacteriums in H2O by polymerase concatenation reaction and cistron investigations. Applied Environment Microbiology 56 pp 307-314 Biomerieux Industry ( 2010 ) APIAÂ ®ID32E [ online ] available: hypertext transfer protocol: //www.biomerieux-industry.com/servlet/srt/bio/industry-microbiology/dynPage? open=NDY_IND_FDA_PRD A ; doc=NDY_FDA_PRD_G_PRD_NDY_17 A ; pubparams.sform=0 A ; lang=en [ accessed 19 March 2010 ] Bahrani- Mougeot F.K. , Paster, B.J. , Coleman, S. , Ashar, J. , Knost, S. , Sautter, R.L and Lockhart, P.B ( 2008 ) Designation of unwritten bacteriums in blood civilizations by conventional versus molecular methods Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontology 105 ( 6 ) pp 720-724. Available: Science Direct [ accessed 11 March 2010 ] Copan Italia ( 2010 ) Why flocked swabs are superior to fibre cloaked swabs and froth swabs and how they can better infective disease nosologies , [ online ] , available: hypertext transfer protocol: //www.mls.be/nieuwsbrieven/css/Why-Flocked-Swabs-are-Superior-to-Fiber-and-Foam.pdf [ accessed 30 Feb 2010 ] Denton, M ( 2007 ) Enterobacteriaceae International Journal of Antimicrobial Agents 29 ( 3 ) available: Science Direct [ accessed 24 Feb 2010 ] Drudy D, O Rourke M, Murphy M, Mullane N.R, Kelly L, Fischer M, Sanjaq S, Wall P, OMahony M, Whyte P, Fanning S ( 2006 ) Characterisation of a aggregation of Enterbacter sakazakii isolates from environmental and nutrient beginnings International Journal of Food Microbiology 110 ( 2 ) pp 127-134 available: Science Direct database [ accessed 18 March 2010 ] Food Market Exchange ( 2001 ) HACCP Hazard Analysis Critical Control Point [ online ] available: hypertext transfer protocol: //www.foodmarketexchange.com/datacenter/laws/detail/dc_lr_reference_haccp [ accessed 17 Feb 2010 ] Galani I, Rekatsina P.D, Hatzaki D, Plachouras D, Souli M, Giamarellou H ( 2007 ) Evaluation of different research lab trials for the sensing of metalo-?-lactamase production in Enterobacteriaeae , Journal of Antimicrobial Chemotherapy 61 pp 548-553 Grant, M.A. , Weagent, S.D. , Feng, P ( 2001 ) Glutamate decarboxylase cistrons as a pre-screening marker for sensing of Escherichia coli groups Applied Environment Microbiology 67 pp 3110-3114 Griffith C.J, Davidson C.A, Peters, A.C and Fielding, L.M ( 1997 ) Towards a strategic cleansing assessment programme: hygiene monitoring and ATP luminometry, an options assessment Food Science Technology Today 11, pp 15-24. Hall L.B and Hartnett M.J ( 1964 ) Measurement of bacterial taint on surfaces in infirmaries Public Health Report 79 ( 11 ) pp 1021-1024, available: PubMed database [ accessed 24 March 2010 ] Horachova, K. , Mlejnkova, H. , Menjnek, P. , ( 2006 ) Direct sensing of bacterial fecal indexs in H2O samples utilizing PCR Water Science Technology 54 pp 135-140 Huang M.M, Arnheim N, Goodman M.F ( 1992 ) Extension of base mispairs byTaqDNApolymerase: deductions for individual nucleotide favoritism in PCR Nucleic Acids Research 20 ( 17 ) pp 4567-4573 Iqbal, S. , Robinson, J. , Deer, D. , Saunders, J.R. , Edwards, C. , Porter, J. , ( 1997 ) , Efficiency of the polymerase concatenation reaction elaboration of the uid cistron for sensing of Escherichia coli in contaminated H2O Lett Applied Microbiology 24 pp 498-502 Janda, J.M and Abbott, S.L ( 2001 ) Bacterial Designation for Publication: When is Enough, Enough? Journal of Clinical Microbiology 40 ( 6 ) pp 1887- 1891 Juck, D. , Ingram, J. , Prevost, M. , Coallier, J. , Greer, C ( 1996 ) Nested PCR protocol for the rapid sensing of Escherichia coli in drinkable H2O , Canadian Journal of Microbiology 42 862-866 Kang D, Eifert J.D, Williams R.C ( 2007 ) Evaluation of Quantitative Recovery Methods of Listeria monocytogenes Applied to Stainless Steel Journal of AOAC International 90 ( 3 ) Kenyon College ( 2010 ) , PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Kenyon College ( 2010 ) PCR sum-up of technique [ image online ] , available: hypertext transfer protocol: //biology.kenyon.edu/courses/biol114/Chap08/Chapter_08a.html [ accessed 20 March 2010 ] Khan, I.U.H. , Gannon, V. , Kent, R. , Koning, W. , Lapen, D.R. , Miller, J. , Neumann, N. , Phillips, R. , Robertson, W. , Topp, E. , Bochove, E. , Edge, T.A ( 2007 ) Development of rapid quantitative PCR check for direct sensing and quantification of culturable and non- culturable Escherichia coli from agiculture water partings Journal of Microbial Methods 67 pp 480-488 available: Science Direct [ assessed 13 March 2010 ] Kubista, M. , Andrade, J.M. , Bengtsson, M. , Forootan, A. , Jonak, J. , Lind, K. , Sindelka, R. , Sjoback, R. , Sjogreen, B. , Strombom, L. , Stahlerg, A. , Zoric, N. , ( 2006 ) The existent clip polymerase concatenation reaction Molecular Aspects of Medicine 27 pp95-125 available: Science Direct [ accessed 11 March 2010 ] .REVIEW Louie, M. , Louie, L and Simor, A. , E. ( 2000 ) . The function of DNA elaboration engineering in the diagnosing of infective diseases Canadian Medical Association Journal 163 ( 3 ) , pp 301-305 Mc Pherson, M. J. , Hames B. D, and Taylor, G. , R. , ( 1995 ) , PCR 2: A Practical Approach Oxford University Press, New York Microbiological hazard appraisal series 10 ( 2006 ) Enterobacter sakazakii and Salmonella in powdery baby expression, Google Books [ online ] , available: hypertext transfer protocol: //books.google.com/books? id=iHZSx2Wfe7EC A ; pg=PA76 A ; dq=enterobacteriaceae+in+food A ; as_brr=1 A ; cd=1 # v=onepage A ; q=enterobacteriaceae % 20in % 20food A ; f=false [ assessed 9 March 2010 ] Mossel D.A, Stryijk C.B ( 1995 ) Escherichia coli, other Enterobacteriaceae and extra indexs as markers of microbiologic quality of nutrient: advantages and disadvantages , Microbiologica 11 ( 1 ) pp 75-90. Available: Medline [ accessed 24 Feb 2010 ] Moore and Griffith ( 2002 ) Factors act uponing recovery of micro-organisms from surfaces by the usage of traditional hygiene swobing , Dairy, Food and Environmental Sanitation 22 ( 6 ) pp 410-421 Mueller, S.A. , Anderson, J.E and Byung, K ( 2009 ) Comparison of Plate counts, Petrifilm, Dipslides and Adenosine Triphosphate Bioluminescence for supervising bacteriums in chilling H2O armored combat vehicles , Water Environmental Research 81 ( 4 ) available: Wilson web [ accessed 24 March 2010 ] Nygren, J. , Svanvik, N. , Kubista, M. , ( 1998 ) The interaction between the fluorescent dye thiazole orange and DNA Biopolymers 46 pp 39-51 Ortega, M.P. , Hagiwara, T. , Watanabe, H. , Sakiyama, T. ( 2009 ) Adhesion behavior and removability of Escherichia coli on chromium steel steel surface Food Control 21 ( 4 ) pp 573-578 available: Science Direct [ accessed 13 March 2010 ] Reilly W.J. , Forbes, G.I. , Sharp, J.C.M. , Oboegbulem, S.I. , Collier, P.W and Paterson, G.M ( 1988 ) Poultry- Borne Salmonellosis in Scotland , Epidermiology and Infection 101 ( 1 ) pp 115-122 Rose, R.E. , Geldreich, E and Litsky, W ( 1974 ) Improved membrane filter method for fecal coliform analysis , Applied Microbiology 70 ( 9 ) pp 5692 5694. Roche PCR Applications Manual ( 2006 ) 3rd ed. , Germany: Fanz and Neumayer Rosrak D.B, Colwell R.R ( 1987 ) Survival schemes of bacteriums in the natural environment Microbial Rev 51 pp 365-379. Tsen, H.Y. , Lin, C.K. , Chi, W.R. , ( 1998 ) Development and usage of 16S rRNA cistron targeted PCR primers for the designation of Escherichia coli cells in H2O Journal of Applied Microbiology 85 pp 554- 560 Van Acker, J. , De Smet, I. , Muyldermans, G. , Bougatef, A. , Naessens, A. , Lauwer, S. ( 2000 ) Outbreak of Necrotizing Enterocolitis Associated with Enterobacter sakazakii in Powered Milk Formula , Journal of Clinical Microbiology 39 ( 1 ) pp 293-297 Wook Oh, S and Kang, D.H ( 2004 ) , Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii , Applied and Environmental Microbiology, 70 ( 9 ) pp 5692-5694. Yang I, Kim Y H, Byun J.Y, Park S.R ( 2005 ) Use of manifold polymerase concatenation reactions to bespeak the truth of theannealing temperature of thermic cycling Analytic Biochemistry 338 ( 2 ) available: Science Direct [ assessed 10 March 2010 ]

Free Essays on Oceania Vs The US

THE DARK SIDE The fictional world of Oceania was a horribly depressing place to live. The only freedom the people of Oceania had was freedom to live for Big Brother and his corrupt system. It’s hard to imagine a world like that if you’re from the United States of America where every citizen has the freedom to do anything within legal limits. Only actual bad conduct, irresponsible behavior, and poor judgment can lead to punishment here in the United States of America. In Oceania anything that wasn’t for the benefit of the system was wrong and punishable. Here we have the freedom to love, to have a family, and to have happiness through other things outside of the government. No one ever had privacy from the party in Oceania. The thought police were always watching through telescreens. In the United States we are free to complete privacy within our homes and limited privacy in public places. The Bill of Rights states that no one can enter and search a home without a warrant. In Oceania peoples’ homes were monitored constantly by camera. Winston Smith’s home was searched after being caught by the party for living with Julia and not living for Big Brother. Like Oceania there is still law enforcement monitoring citizens, but it’s in a completely different level. The party manipulated the people of Oceania with phrases like â€Å"freedom is slavery†, â€Å"war is peace† and â€Å"ignorance is strength†. This doesn’t happen here in the United States of America today. The meaning of a word is the meaning of the word. Double think doesn’t exist, opposite meanings aren’t the meaning itself. In the Ministry of love prisoners were tortured in many ways. They were broken down to nothing simply because they didn’t live good enough for Big Brother. This doesn’t seem like it should be called a Ministry of Love. Anyways, obeying the party’s exact wishes was impossible. How can you force ... Free Essays on Oceania Vs The US Free Essays on Oceania Vs The US THE DARK SIDE The fictional world of Oceania was a horribly depressing place to live. The only freedom the people of Oceania had was freedom to live for Big Brother and his corrupt system. It’s hard to imagine a world like that if you’re from the United States of America where every citizen has the freedom to do anything within legal limits. Only actual bad conduct, irresponsible behavior, and poor judgment can lead to punishment here in the United States of America. In Oceania anything that wasn’t for the benefit of the system was wrong and punishable. Here we have the freedom to love, to have a family, and to have happiness through other things outside of the government. No one ever had privacy from the party in Oceania. The thought police were always watching through telescreens. In the United States we are free to complete privacy within our homes and limited privacy in public places. The Bill of Rights states that no one can enter and search a home without a warrant. In Oceania peoples’ homes were monitored constantly by camera. Winston Smith’s home was searched after being caught by the party for living with Julia and not living for Big Brother. Like Oceania there is still law enforcement monitoring citizens, but it’s in a completely different level. The party manipulated the people of Oceania with phrases like â€Å"freedom is slavery†, â€Å"war is peace† and â€Å"ignorance is strength†. This doesn’t happen here in the United States of America today. The meaning of a word is the meaning of the word. Double think doesn’t exist, opposite meanings aren’t the meaning itself. In the Ministry of love prisoners were tortured in many ways. They were broken down to nothing simply because they didn’t live good enough for Big Brother. This doesn’t seem like it should be called a Ministry of Love. Anyways, obeying the party’s exact wishes was impossible. How can you force ...

Natural Selection Concept Redesign Research Paper

Natural Selection Concept Redesign - Research Paper Example Modeling that involves students’ hands-on involvement can help them better understand the actual biological processes. These activities require minimum expenses at a considerably affordable cost (Pugesek, 2003). Other teaching resources included in this concept comprise games, group discussion activities, activities based on the web and general ideas of fundamental biological areas, for example, common delusions, major theories, and recommended learning activities. These activities will enhance learning and remembrance. The only bias will arise in believing that all members of e.g. a group discussion are at per. The level of students’ commitment in each of the learning method will determine its success (Pugesek, 2003). Roselli (2011), describes six activities that can be used by instructors to enrich their teaching and understanding of introductory biology lessons. For undergraduate students, these systematic activities should begin with an introduction to natural selection (Roselli, 2011). It should encompass what natural selection is in simple terms and how it takes place. Discuss in details the sexual selection and molecular evolution as the second and third activities respectively. The fourth topic should entail the evolution of compound traits followed by a fifth topic on the evolution of behavior. By doing this, students will have a chance to perceive how natural selection works in different perspectives (Roselli, 2011). Testing involving pre- and post-instruction showed a substantial increase in students’ perception of natural selection after these learning successions were completed. Continuous testing through the unit proved a continual rise in student understanding. Assessments showed students relished the activities (Roselli, 2011). Nevertheless, the method does not incorporate hands-on involvement of the students in activities such as group discussions.

Corporate Social Responsibility Essay Example | Topics and Well Written Essays - 1750 words

Corporate Social Responsibility - Essay Example Corporate Social Responsibility There are various potential conflicts in the method of preparing documents and construction of strong approach and business activities. Corporate Responsibility is just a relative approach and has an objective basis, which is also known as unsustainable development methodology (Aras, Aybars and Kutlu, 2010). It is also considered as a radical managerial approach. The various other CSR theories help in development of continuums with the focus on integration of business activities with community activities. Organizations have developed several measures for dealing with the strategic societal, environmental and community needs which have led to the incurring of huge amount of expenditure in the organizations. Small and medium enterprises do not have the necessary resources for developing or implementing the CSR tools and approaches (Burger, 2011). When a company wants to improve its social performance, it divulges itself through social activities like providing charitable donations, org anizing charitable associations and sponsoring activities. The study will deal with the concepts of CSR and its role in financial crisis along with its future prospects. The author of the study will also highlight the relevance of CSR and the guidelines for implementing CSR techniques developed by leading associations. Finally, the study will also incorporate the various legal requirements, regulations and guidelines related to the CSR concept. Evolution & History of Corporate Social Responsibility Corporate Social Responsibility (CSR) is regarded as a technique which helps the organization in its evaluation of the business activities and its impact on the society and environment through ethical and transparent decision making (WBSCD, 2013). CSR has evolved as a challenge for the entire business and academic community as it involves a time consuming systematic approach and also a thorough knowledge of the existing sustainable issues (Chen, 2011). From the academic perspective, it ha s become one of the most relevant and purposeful research topics which have provided relevance to the functioning of the organizations (Chen, 2011). In the academic perspective, it has moved on to an overall new organizational level which already includes the impact on the organizational outcome. Theorist Carroll (1960, cited by Chen, 2011) has laid emphasis on the theoretical orientation of the normative and performance oriented ethics which have the ability to increase the organizational outcome. This in turn have a positive impact on the exiting business systems. The evolution of CSR concept has been associated with the inception of the subject of organizational behaviour. In 1919, the shareholders of Ford had decided to grant the request of the Dodge brothers for maximum dividends. This decision was made by the director of the company, Mr. Henry Ford whose main intention was to reinvest the accumulated gains of the company on plant expansion. He stated that one of the major obje ctives of Ford was to cater to the betterment of community development. William Clay Ford Jr had tried his best to convince the existing shareholders regarding the organization’s contribution towards the welfare of the entire society and community. Theorist Bowen (1980, cited by Chen, 2011) had regarded that organizations are vital fulcrum of power and the actions of the organizatio

Buddhism in china, Korea and japan Assignment Example | Topics and Well Written Essays - 250 words

Buddhism in china, Korea and japan - Assignment Example On persuasion by his student, Shariputra, Buddha agrees to teach the meaning of this Sutra. However, most of the followers leave after this, as they doubt the legacy of this Sutra. As revealed by Buddha, during his teachings of Lotus Sutra, the burning house is a huge mansion with many rooms. The children in this house are busy in their play, without noticing the dangerous creatures crawling on the floor. When the house is under fire, the father of these children urges them to come out and promises that a cart is waiting for them outside. The underlying message indicates that most of us are pursuing the material gains, without noticing the dangers that accompany them. The lotus floats, clean and dirt-less, above the surface of muddy pond. The teachings of Budda take the form of cart to take us away from the greed that we all are pursuing in this material world. Hoolboom, Mike â€Å"Burning House: Betrayal as Innovation† The goal of practice is compassion, Center of Gravity, 25 February 2012, Web 05 Nov 2013:

General Motors Human Resources and Management

General Motors Human Resources and Management This report presents an analysis of the mission statement of General Motors as well as its key business processes. It also illustrates how the key business processes integrate with the information systems and our suggestions and recommendations to those processes that would better suit General Motors. The report also identifies the environmental factors which affect the company in terms of political, economic, social, ecological and technological factors and the impact that these factors have had on General Motors and the strategic diversity the company has had to adopt to accommodate these changes. Finally the report explores ways on how new information systems can help General Motors create great efficiency by automating and streamlining parts of its business processes. The report concludes by incorporating our recommendations of appropriate information systems for each department within the company. Introduction General Motors is the worlds largest automaker with 386,000 employees in over 50 years. Despite this sheer size, its auto sales have declined from about 60 percent of the U.S. vehicle market in the 1970s to only 28.3 percent today. This decline is attributed to stiff competition from Ford, DaimlerChrysler and the Japanese all of whom enjoy lower production costs, have a reputation for cars with better styling and quality than General Motors. General Motors adoption of a vertically integrated corporation which at one time manufactured up to 70 percent of its parts, as a power source of competitive advantage, enabled the company to build cars at lower costs than its rivals. However, over time, these policies worked in favour of General Motors competitors who were then able to make motor vehicles at much lower costs because they could purchase their vehicle parts from outside vendors and also bargain on pricing. For the past 15 years, General Motors has struggled to overcome the above legacy, inefficient product processes and thousands of outdated information systems that could not communicate with each other. Although the company has now become much leaner and more efficient by shedding off tens of thousands of workers, closing dozens of plants and squeezing costs of motor vehicle parts by scouring the globe for the lowest prices much still needs to be done. It is our recommendation that General Motors use Internet and other leading-edge information systems technology to reconstruct its entire value chain, transforming itself into a customer-focused business that provides many different electronic services to consumers as well as motor vehicles. Mission Statement General Motors mission statement states that GM is a multinational corporation engaged in socially responsible operations, worldwide. It is dedicated to provide products and services of such quality that our customers will receive superior value while our employees and business partners will share in our success and our stock-holders will receive a sustained superior return on their investment. We analysed the above mission statement using Druckers five questions namely:- What is our business? Who is the customer? What is the value to the customer? What will our business be? What should our business be? We arrived at the conclusion that there was a need to modify General Motors mission statement since the above questions were not fully exhausted. The current mission statement does not indicate that GM is a producer of motor vehicle; neither does it take into consideration the Global Sullivan Principle. As a marketing tool, it does not mention that it is dedicated towards providing products and services to customers who are targeted in 200 different countries. Our recommended General Motors mission statement should read as follows: GM is a multinational producer of motor vehicles engaged in socially responsible operations worldwide and committed to achieve the best in every facet of our business. Under the aspects of Global Sullivan Principles, GM is dedicated to provide products and services of such quality that our customers who are targeted in 200 different countries will receive superior value while our employees and business partners will share in our success and our stock-holders will receive a sustained superior return on their investment. Key Business Processes Key business process is defined as the execution of a series of activities that work together to produce a well defined set of products and services which leads to the achievement of a measurable business result. They also represent unique ways in which organisations coordinate work, information, and knowledge, and the ways in which management chooses to coordinate work. Integration between Business Process and Information Systems Although each organisation has its own set of business processes, many other business processes are cross functional, transcending the boundaries between sales, marketing, manufacturing, research and development. These cross functional processes cut across the traditional organisation structure, grouping employees from different functional specialities to complete a piece of work. Information systems can help organisations achieve great efficiencies by automating parts of these processes or by helping organisations rethink and streamline these processes. By integrating these processes, organisations can become more focussed on efficient management of resources and customer services. Suggestions and recommendations of key business processes Functional Area Business Process Manufacturing and Production Assembling the product, checking for quality, producing bills of materials Sales and Marketing Identifying customers, making customers aware of the product, selling the product Finance and Accounting Paying creditors, creating financial statements, managing cash accounts Human Resources Hiring employees, evaluating employees job performance, enrolling employees in benefits plan External Environment There are three factors which had made General Motors in this situation. Firstly, the United States economy is not progressing cost their U.S. sales projections for 2008 have been too rosy. GM had been expecting more than 16 million vehicles, including trucks and buses, to be sold this year (Taylor III 2008). Secondly, intense competition from their global competitors such as Honda, Nissan, and Hyundai which had produce better fuel efficient engines, stylish at a much lower price compared to any GM brands. Thirdly, the worlds fuel price had increased to USD 120 per barrel in the market had made consumers not to purchase vehicle and using public transport or smaller vehicle. In the United States, consumers want to abandon their less-fuel-efficient vehicles for smaller cars, and thats illustrated by all sorts of trends, said David Tompkins, executive director of industry solutions for Edmunds.com, parent of Auto Observer (Buss 2008) (refer appendix 2). 1.0 Strategic Human Resource Management Theory 1.1 Balance Score Card Balance Score Card is a performance measurement indicator that can be used to measure the financial and non financial situation in General Motors. There are four parts; financial perspective, internal business perspective, customers perspective, learning and growth perspective. Balance Score Card is like your cars dash board where there is indicator on as you drive, you can look at the dashboard to obtain real-time information such as how fuel, speed and the distance youve traveled or even any faulty system etc. Its known to help companies and implement the changes required to meet their business goals (Pangakar Kirkwood, 2007). The balance score card enables the companies to develop a more comprehensive view of their operations and to better match all operating and investment activities to long- and short-term strategic objectives (Punniyamoorthy Murali, 2008). The loss of USD38.7 billion is a huge financial loss which in fact will affect the internal business process, the customer, and growth of GM. The huge loss was largely contributed from deferred tax charges and drop in sales. Currently, the organization financial perspective appears to the share holder is in a decline where GM shares fell nearly 5 percent, or USD1.67, to USD34.48 (Bunkley N. 2008). Thus to manage this losses, thousands of workers are laid off from duty. This will affect their internal business process and may lead to dissatisfied customers. For example, usually General Motors takes 1 week to deliver a car to a customer. When they decided to retrench workers they will lose their competitive advantage where now it takes 2 weeks to deliver a car. This will cause dissatisfaction to consumers because they have to wait an extra week to obtain their vehicle. In the end, the learning and growth perspective cant be achieved because the lack of resources will disable them to co mpete in the turbulent environment result to decline in sales. To ensure that General Motors can effectively achieve its balance score card in the future, they must handle their external environment issue concisely. They have to improve thru their internal process and learning and growth to overcome their competition issue. General Motors have to come out with new design and technology to increase the product line. Research and Development expenditure have to be spent so that they could create better vehicle then their competitors. How to create better vehicle than the competitors? This can be accomplished by purchasing the technology from their competitors or similar industry. For example Proton had acquire Lotus in the year 1996 had made them competitive at that point of time. When this happen, employees will have to be train thus it can increase the knowledge of the workers. In certain cases, workers will be sent oversea for such training to acquire technology. Workers will be more effective and consequently increase productivity in General M otors. Like a well oiled machine, every part in the organization performs best when all of them work towards a common goal. All of the four perspectives in the balances score card works hand in hand thru their substantial objectives, measures and initiatives. As mentioned above, to make sure that General Motors can make profit to cover the huge amount of losses they must increase productivity, more expenditure on research and development etc. In General Motors case, financial perspective is the key strategy for the other three perspectives. For General Motors, the learning perspective can work together with the sales department to train and coach the sales staff or even developing new efficient production, training equipment. To improve on the customer scorecard they could do research by surveys from their existing customers on how to improve customer relationships. Customer retention is important factor ignite buyers to increase sales. It ensures repeat purchase, increase positive word of mouth and reduce cost to find new customers. Balance Score Card will ensure human capital development, improving employee satisfaction and increasing employee motivation (Kaplan Norton, 1992) in General Motors. Link of each perspective in the Balance Score Card (BCS) High Performance Work System High performance work system (HPWS) is also another method to explain the situation in General Motors. Autonomous work teams, open systems and performance-based pay are known collectively as high-performance work systems (Rouse, 2000). HPWS have also come to be known as high involvement work systems, flexible work systems and high commitment work systems (Aghazadeh Seyedian, 2004) In other words, they are simply work practice that can be deliberately introduced in order to improved organizational performance The main focus of HPWS is organizing work so that the employees participate in decisions that affect the everyday operations of an organization. There are three potential factors that can affect high performance work system in General Motors; retrenchment of workers, technology used and layout design. A worker is the key success to any organization. Retrenchment will cause General Motors to lose talented workers subsequently lose competitive edge. To survive in the changing environment, a company must rely on their workers creativity, ingenuity problem solving ability and strong team work. Workers are able to make their own decision on the best way to accomplish their work. The knowledge and skill shared will create a high performance work system. For example, an engineer in General Motors is developing a fuel efficient engine. Engineer A may need assistants from Engineer B, however when GM decided to retrench workers, Engineer A will face difficulty in developing the engine. Performance of employee can be boost thru team works. A study by Thompson, Baughan and Motwani indicates that company such as General Electricity, Proctor Gamble, Xerox Corporation had huge increase productivity as high as 250 percent and double their profit (1998). The use of technology is another feature in High Performance Work System. All managers in every department of General Motors must be able to identify the technology they use in their organization. The application of Human Resource Information System that can store information on workers that can assist managers in deciding which employee is performing and which is not. The use of technology without human operating it is also meaningless. Managers in General Motor must identify whether the qualified workers are able to operate the tools or not. Layout of General Motors production plants and office be required to properly design in order for them to increase workers performance and productivity. This involves careful job designing by HR managers. According to Aghazadeh and Seyedian, layout plays a role to ensure success by using space, people and equipment effectively, increasing the flow of information and materials, boost employees morale and utterly encourage flexibility (2004). Managers in General Motors may have to come out with proposals to change the existing layout to a improved, sustainable working layout. If all of the three factors are taken into account, General Motors can recover from their huge financial losses just and can avoid retrenchment of employees. Although to implement HPWS is costly, uncertain success and time consuming but in the long run this can benefit General Motors. Recommendation for Human Resource Activities Training and development programs should be given to employee to ensure increase in productivity. Offshore training in Japan car manufacturers to learn various methods to make better cars. Mangers are required to make research and human resource planning on the best methods to do a particular task. General Motors would have to find a partner to form a strategic alliance to recover from the huge financial loss. From this alliance, both companies are potential to learn from each other on the technology and trade secrets. Develop a module which to help retrench workers to find a new job. This will avoid them from paying more money for their compensation of retrenchments Outsource to countries like China or India. Cheap labors will benefit companies to recover them from financial loss. Create a reward programme where employees are rewarded by their managers based on their ability to work in a group Create a talk to all employees at least once in 3 months to explain the companys vision, strategy and objective. This will make employees feel a sense of belonging and may be able to work extra for the company. Competitor Analysis Sheer size and market share make new entrants an unlikely to be a threat Vertical integration of GM does not encourage purchases from suppliers hence they lose out on price bargaining Ford, DaimlerChrysler and Japanese manufacturers have better styling and quality; an approach which GM should consider adopting to sustain its competitive edge Cost of GM motor vehicles is perceived as being too high Buyers are nowadays inclined to buy sport utility and pickups which are not manufactured by General Motors GM enjoys a healthy product line and segmentation in pricing and functions Information Systems Using information systems at each part of the organization creates great efficiencies by automating and streamlining parts of the business. We recommend the following information systems at each department within General Motors: Human Resource Information Systems These are systems that maintain employee records, track employee skills, job performance and support planning for employee compensation and career development. LEVEL RECOMMENDED I.S. PURPOSE Operational Employee Records Track employee training, skills and performance appraisal Knowledge Career Path Designs career paths for employees Management Compensation Analysis Monitors the range and distribution of employees wages, salaries benefits Strategic Human Resources Planning Plans the long-term labour force needs of the organization 2. Finance and Accounting Systems These are systems that keep track of the firms financial assets and fund flows. LEVEL RECOMMENDED I.S. PURPOSE Operational Accounts Receivable Track outstanding debts Knowledge Portfolio Analyses Designs portfolios investments Management Budgeting Prepares short-term budgets Strategic Profit Planning Plans long-term profits 3. Sales and Marketing Systems These are systems that help the firm identify customers for its product or services. They also assist to develop product or services that meet customer needs, promote and sell them as well as providing ongoing customer support. LEVEL RECOMMENDED I.S. PURPOSE Operational Order processing Enters, processes and tracks orders Knowledge Market Analyses Identifies customers and markets using data on demographics, markets, consumer behaviour and trends Management Pricing Analyses Determines prices for products and services Strategic Sales and Forecasting Prepares 3-5 year sales forecast 4. Manufacturing and Production Systems These are systems that deal with planning, development, production of products and services and controlling the flow of production. LEVEL RECOMMENDED I.S. PURPOSE Operational Machine Control Controls the actions of machines and equipment Knowledge Computer-Aided Design Designs new products using the computer Management Production Planning Decides when and how many products should be produced Strategic Facilities Location Prepares and decides where to locate new production facilities In addition to the information systems mentioned here above, we also recommend the following office automation systems: E-mail System: Improve GMs internal and external communication, creating an effective and efficient service Word Processing System: Office system technology that facilitates the creation of documents through computerized text editing, formatting, storing and printing Document Imaging System: System that converts documents and images into digital form so that they can be stored and accessed easily by the computer Timesheet System: Enables employees to fill in the timesheet forms online so that management can approve and track the timesheet online. Conclusion Whilst it would be make a lot of business sense for a company like Ford to close down more plants and accept a smaller portion of the U.S. market this strategy would not work in favour of GM because then the company would produce and sell fewer vehicles, meaning less income for those big pension and health-care costs. GM has to maintain its cash flow to cover these costs until a future date when it is hoped that the elderly retirees diminish in number whilst also making improvements in quality, efficiency, design and brand appeal. Although GM has cut the time to assemble a vehicle from an average of 32 hours in 1998 to 24 hours in 2003, Japanese competitors are still faster in getting new models into the market. Hondas new vehicle development cycle is only 14 months and the company is working towards compressing development time down to 12 months. GM should look at this as a challenge to embrace and strategise with a view to improve its development cycle to match its competitors if not exceed them. Whilst these recommendations provided are meant to help GM sustain its market share, they cannot be fully appreciated until they have been put to test and the results obtained critically analysed to create room for adjustments where necessary and where applicable.

West Side Story Analysis Essay -- essays research papers

Characters/Roles. 1.  Ã‚  Ã‚  Ã‚  Ã‚  Riff- He is the leader of the Jets. Founded it with Tony. A wild man that acts like a punk and dies in a fight. 2.  Ã‚  Ã‚  Ã‚  Ã‚  Bernado- Leader of the sharks, the Puerto Ricans, he is a young immigrant to America. He dies in a fight with Riff, but Tony kills him. He is integral in helping to spur the gang rivalry between the Sharks and the Jets. 3.  Ã‚  Ã‚  Ã‚  Ã‚  Maria- She falls in love with Tony, a rival jet. They become lovers and due to her Tony dies, and the gang wars end. 4.  Ã‚  Ã‚  Ã‚  Ã‚  Officer Grubky- A policeman, he hates both gangs, but favors the Jets. He helps to split the fights up. 5.  Ã‚  Ã‚  Ã‚  Ã‚  Tony- He helped to found the jets with Riff. Decided to go strait, but gets pulled back in. Dies due to his love with Maria. 6.  Ã‚  Ã‚  Ã‚  Ã‚  Baby John- The youngest of the Jets, he is the â€Å"baby† of the gang, and tends to be the voice of reason because he is not totally emotionless. Plot Two gangs, the Sharks and the Jets, are in the middle of a turf war. However, two people, one from each side, fall in love. In a plot that is as Shakespearian as it gets, many of the characters die over pointless ends, all the time the love of Maria and Tony blossoms, but even Tony can’t escape the cruel fate, and is killed. Songs out of place I believe that all of the songs fit in the play. They are all able to capture the emotions that are expressed durin...

Secrets and the Scarlet Letter

â€Å"A secret between two is God's secret, between three is all men’s. †-Spanish Proverb. Secrets are not meant for being told. Usually everyone is supposed to take secrets â€Å"to their grave. † In certain circumstances, they must be told. Even though you’re thwarting your own honor by telling a secret, sometimes it must be done. In most cases, secrets should be kept, but in The Scarlet Letter, there are some that need to be told. There's nothing more powerful than finding someone safe to tell â€Å"the secret† to. No one knows how hard it is, unless they've been there. Your heart pounds, your body is rock rigid, you grind your teeth, your mouth is dry. You think of all the excuses to keep your mouth shut. They'll get mad. They'll laugh. They'll reject you. They'll treat it like it was nothing and tell you to forget about it. Or worse: they'll be polite, nod their head like they understand, leave and not ever have anything to do with you again. Even then, the depth of doubt, self-hate, fear and insecurity is so strong, that even after you tell even to someone who's been through it too you leave and wonder, did I say too much? Did I do the right thing? Will they hate me? Only experience lets you know your trust wasn't for nothing. In the Scarlet Letter, Hester Prynne, Roger Chillingworth, and Arthur Dimmesdale all have secrets. They will do whatever they can to keep their secrets a secret. Except for Hester, whose secret has been made public by her wearing the scarlet letter A. Arthur Dimmesdale’s secret is the most lethal. He is keeping his secret to protect his reputation even though it’s eating away at him and keeping him from what he wants most; Hester. For example, in chapter 17 page 182, we are told that Dimmesdale’s secret has taken hold of his life and made him a miserable man. â€Å"There is no substance in it! It is cold and dead, and can do nothing for me! Of penance I have had enough! Of penitence there has been none! Else, I should long ago have thrown off these garments of mock holiness, and have shown myself to mankind as they will see me at the judgment-seat. Happy are you, Hester, that wear the scarlet letter openly upon your bosom! Mine burns in secret! Thou little knowest what a relief it is, after the torment of a seven years' cheat, to look into an eye that recognizes me for what I am! † Dimmesdale’s secret should be told because then he won’t feel so guilty and his shame and hypocrisy will not eat him alive. It also isn’t fair to Pearl that she has no father and won’t be able to have one because of Dimmesdale’s secret. She has no knowledge of him being her father because of what he had to do to protect his name. Girls should have a father figure in their lives, Pearl never had that opportunity. Roger Chillingworth also exhibits secrecy. He’s keeping his identity a secret because he wants to find out who Hester’s acquaintance was and he also wants to protect his high reputation as well. It isn’t right for him to keep his identity a secret because it’s putting other people in harm’s way which is a circumstance when secrets need to be told. The torture he’s doing to Dimmesdale isn’t dignified and un-puritan like. In chapter 14, Chillingworth says â€Å"I have left thee to the scarlet letter, if that have not avenged me I can do more! † This quote says that Chillingworth is willing to do more to Dimmesdale and make him suffer more which is making Chillingworth’s secret deeper because the more he does that Hester knows about, the more guilt she feels about keeping his identity a secret from Dimmesdale. His secret should be told because it goes against moral values of the puritans. In some cases, secrets shouldn’t be told. Those who keep a secret keep themselves moral. Keeping a secret and respecting the secrets of others, as opposed to prying into them, is a virtue of self discipline and sensitivity. The heart can be seen as a safe for keeping secrets. Intelligence is the lock, and will power is the key. Keeping secrets is important for your dignity, pride, and personal gain. In response to The Scarlet Letter, Hester Prynne is the only one who knows the secrets that Dimmesdale and Chillingworth are hiding from the townsfolk. Hester has to control her desire to tell the truth and practices the art of deception to hide these secrets. When she will not reveal the father of Pearl, Reverend Dimmesdale says, â€Å"She will not speak. † It is ironic that the person who committed the sin with Hester is the one who announces publicly that she will not reveal the name of the other sinner. Later, Chillingworth wants to know who it is and he says, â€Å"Thou wilt not reveal his name? † Hester refuses and continues to hold her silence. Then, Chillingworth, still trying to find out the name of her lover, comments, â€Å". . . but Hester, the man lives who has wronged us both! Who is he? † When he says this, he is hinting that he is going to do something to Dimmesdale. This is why Hester makes Chillingworth promise not to kill her lover if he finds out his identity. Chillingworth deserves to know who slept with his wife, although Hester should not have had to tell him. I think that Dimmesdale should have admitted that he was Pearl's father. Today, if a priest admitted such a crime, he would probably be sent to jail. However, in the novel, had Dimmesdale confessed, the townsfolk would have liked him even more. Hester also has to live with, and conceal, the secret that Chillingworth is her husband. When he comes to visit her in jail he says, â€Å"Thou hast kept the secret of thy paramour. Keep, likewise, mine! There are none in this land that know me. Breathe not, to any soul, that thou didst ever call me husband. † Hester shows great strength of character by her ability to keep the secret identities of her lover and her husband. There must have been times when the temptation to reveal her secrets was overwhelming, but she managed to do so. There are times when secrets must stay secrets and times when they should be told. The Scarlet Letter is an allegory for secrets. Chillingworth and Dimmesdale’s secrets should be told because they’re doing things for the wrong reasons and hurting either themselves or those around them. It was right for Hester to keep secrets throughout the book because she was looking out for herself, Pearl, and Dimmesdale and would do anything to make sure they weren’t in harm’s way of Chillingworth’s wrath. When it comes to secrets, to each their own. With different situations comes different ways to handle the condition and decide whether or not a secret should be held in or expressed for the world to hear. In most cases, secrets should be kept, but in The Scarlet Letter, there are some that need to be told.

The Misfortune of Love

The Misfortune of Love â€Å"The Torments of Love† is a fascinating trilogy that explains the nature of love and how vain it can be. It is the story of a young woman Helisenne who was married at the tender age of 11 years, to a much older man. Initially they shared a perfect marriage worth coveting. However, this was only because of Helisenne’s innocence who was both young and naà ¯ve at the time.Advertising We will write a custom term paper sample on The Misfortune of Love specifically for you for only $16.05 $11/page Learn More She is portrayed as a chaste and noble lady who is set to be the model wife, respectful and admired by all. However, with the exposure to new environment she becomes wise in the ways of love. Such exposure leads to an adulterous affair with Guenelic, a younger male of seemingly noble origin. The flight to fantasy land reveals the vanity of love brought about by much suffering such that she ends up regretting existence and wishes that her cr eator would not have let her live beyond her childhood. In the book, De Crenne highlights the two types of love: lascivious love; illicit vain and full of suffering; and matrimonial love noble; chaste and worthwhile. This story therefore is an expression of how the power of lascivious loves over matrimonial, how vain it can be and why people should pursue more worth while ventures. Crenne views marriage as a very sacred and holy institution held in deep reverence by those in it (8). Chastity is the rock under which perfect marriages are built on. A married person has to be both chaste in heart as well as in character: the things that a married person does must reflect a chaste spirit from within. As such a married person especially a woman has to avoid all the trappings of the search for pleasure. With regard to pleasure, Crenne says that it can be found in abundance within marriage and as such, a person has no reason to go searching for it outside the marriage (8). Furthermore a ma rried person holds a very important position in the society and as such has to uphold dignity so as to retain that position (9). Married women are subject to public scrutiny by society and are much more liable to blame and condemnation should they commit any form of misdemeanor such as having affairs with other men. Therefore Crenne sees women as the carriers of dignity not only in marriage but also in the society (9). Men on their part have a free ticket and are allowed to have extra marital affairs without any blame; the kings, princes and such other men of noble background, without criticism from the society, publicly express their affection for Helisenne, despite knowing that she is married.Advertising Looking for term paper on american literature? Let's see if we can help you! Get your first paper with 15% OFF Learn More It is Helisenne who is watched carefully by the society to see if she will fall for the traps set by such men (10). This is an expressi on of how women are discriminated in the society. Furthermore a chaste wife upholds not only her dignity but also that of her husband (10). It takes great fortune to have great marriage; for it would not be attributed to anything other than fortune for a person to marry a total stranger. Marrying a total stranger and finding that they are ‘agreeable† is just a matter of fortune (8). Helisenne was married to a stranger soon after she turned 11. She was lucky to have found an adorable husband (8). Such occurrence can thus be attributed to nothing but luck. The irony of such fortune is that it can turn out to be a misfortune. At such an early age one is bound by the innocence and naivetà © of the new found love. The misfortune is compounded by the societal norms and beliefs such as choosing one’s marriage partner, rather than being let to choose whom one loves. This is the beginning of the misfortune of love. Marriage founded on such innocence and naivetà © is full of love and pleasure, inexplicable beyond words. The marriage partners in such a case find it easy to love and reciprocate love (8). Such a marriage lacks nothing and whatever little there lacks a person is motivated to persevere for the sake of love; Helisenne persevered for three years with poor health as a result of her early marriage but went through the suffering gladly in the name of love (8). Furthermore due to the innocence of such a young couple the marriage is full of â€Å"delight and amusement pleasure† (10). Perfect marriage survives on reason and logic. Therefore, a married person should let reason (chastity) prevail over bodily desires (adultery) so as to maintain marriage (10). The partners find a lot of pleasure in each other’s company and support. The couples find it easier to do things together thus; â€Å"together when the desired day came, we went to the said city to increase (our) chances of winning the court case† (9, 10). This is in refe rence to Helisenne’s great journey to a new city to fight for their land. Such is the honor of a marriage of young and innocent people. It has no blemish (10). However such a marriage lives as long as the couple remains locked up in their own world because sooner or later nature may call upon a person to move from one place to another.Advertising We will write a custom term paper sample on The Misfortune of Love specifically for you for only $16.05 $11/page Learn More Such a change of scene presents one with the opportunity to discover new things, which includes new people. Such discovery exposes the young, naà ¯ve and unnatural love to new challenges. This exposure may lead one to find other people with whom one may fall in love with, naturally. This new love is beyond comprehension and can only be compared to madness (73). When this occurs it is the beginning of an adulterous affair. Such affairs are full of passion and uncontrollable craving for insatiable pleasure. Initially a person may make the best efforts to fight and maintain the chastity but eventually and slowly will succumb to the unimaginable urge to be with the new found love. Furthermore such an adulterous affair starts as an innocent physical attraction that grows with time (10). Such illicit love is held in great secret. It is like a snare and once it captures its victims it makes them totally helpless and only depend on it for survival (16). Such love can be arrested before it grows beyond control by reducing the proximity between the two lovers (10, 73). This means that physical distance and the frequency of contact are what motivate this love to grow stronger and stronger. Moreover, the secrecy in which it is ducted only adds more fuel to the fire. Crenne continues to explain the there are two types of love: lascivious (adulterous affair) love and chaste (matrimonial) love (10). Lascivious love is illicit, full of vain and hope as the married person always harbors unending fantasies of being with their secret lover. Such fantasies only lead to physical, psychological and even spiritual turmoil (201). What is more surprising is the fact that the individual who finds illicit affection to a secret lover cannot hide that love for long as the love is too strong that it causes a person to change their general mannerism. The behavior change betrays one’s inner feeling. Married people who find themselves in illicit affairs may want to fight the urge and keep it secret until the day they die, but slowly it starts to consume them such that they drop their guard and start defending such an adulterous affair. The pillars that kept a person chaste soon start to carve in under pressure and as such unreason slowly sets in. This is the genesis of breaking up of a marriage that initially seemed immune to such. As a result of the unreason of lascivious love a person in love can defend the infirmities of those they love to justify the love. Reaso n no longer prevails. Instead reason takes a new meaning such that it is only what is done in the name of love that seems reasonable. So unreasonable is the new craving for love that even respect for God slowly wanes. Even such places of worship as temples are converted into places of opportunity to practice such infirmities (Disse12).Advertising Looking for term paper on american literature? Let's see if we can help you! Get your first paper with 15% OFF Learn More A person cannot love two people especially if one of them was a person for whom one was forced to love. Surprisingly though, love can be transferred from one person to another thus; â€Å"the love (that Helisenne) felt for her husband now belonged to her secret lover† (13). Such illicitly attained love can only be maintained through illicit means. The person who previously espoused the virtues of honesty and integrity acquires new tastes: to cheat, to lie, to betray and to pretend so as to maintain the new love. This is out of the anxiety created by the knowledge that something that is easily obtained is easily devalued. For there to be any appreciation of love one has to persevere through great odds and suffer great consequences so as to appreciate that priced possession (25). Such is the controlling nature of lascivious love. Such love is also full of doubts worries about its present and future existence (66). Love, whether chaste or illicit, is such a powerful force in lif e that it is the whole essence that motivates people to continue living. It is what adds meaning to an otherwise meaningless life. It is so important that when it is denied to a person, the need to live dies. People can spend their entire lifetimes looking for love, journey to great countries, engage in war and go through the great odds in search of it (77). Helisenne’s husband lived for the love of his wife, going to such great lengths as to threaten to kill her secret lover, as well as lock her up in effort to separate her from illicit lover. After realizing that Helisenne had been locked up Guenelic, her secret lover, out of his love for her sets out to search for her, the result of which is the journeys through out the world in search of there Helisenne had been locked up by her husband. Helisenne the former chaste, noble and faithful wife, upon discovering the attraction of secret love spends her entire life searching for her secret love. Crenne adds that even some of th e most important personalities such as Socrates were also victims of this domineering phenomenon (93, 94). The effort that is put to seek love is so great that one would expect a better life after such great love is found. However the opposite is true. Such love is just vain. It leads to nothing. After all the suffering and torment a person goes through such love does not lead to freedom. People who commit their lives in pursuit of this kind of life and love are exposing themselves to suffering anguish and possibly death; death being the ultimate end of the pursuit of such desires (201-214). Because of the vanity of such love Crenne advices ladies of nobility to look for something much more valuable to do other than search for love that would lead them nowhere thus; â€Å" exhorting all fair ladies to love sparingly well, chastely and avoid all manner of vain and unchaste love† (7). It is better to be chaste, dignified, and to avoid the pursuit of the pleasures of love. Chast e love is fulfilling. However, the search for illicit pleasures of love is the real cause of much suffering and affliction. Such affliction makes one not only loose their status in the society but also their life. This it is more important to commit ones life in pursuit of other noble course other than love. De Crenne, Halisenne. The Torments of Love, Minneapolis, MN: University of Minnesota, 1996. Print Disse, Dorothy. Helisenne de Crenne /Marguerite de Briet (d. aft.1552). Other Women  Voices. 2011. Web.